Journal: bioRxiv

Article Title: The Nerve Growth Factor IB-like Receptor Nurr1 (NR4A2) Recruits CoREST Transcription Repressor Complexes to Silence HIV Following Proviral Reactivation in Microglial Cells

doi: 10.1101/2021.11.16.468784

Figure Lengend Snippet: A, RNA-Seq confirmation of Nurr1 KD in HC69 cells. Read histograms for the Nurr1 locus is shown for non-targeting shRNA-infected cells, and cells infected with Nurr1 specific shRNA lentiviral constructs. Annotated genes for the shown locus are indicated on the top, and the position of the locus on chromosome 2 is shown both at the top and the bottom. A read scale for each row is shown on the right, with the values for the knock down studies drawn on a linear scale. B, Schematic depicting the TNF-α stimulation and chase studies. The two shRNA lentiviral transduced cell lines described in A were either untreated or treated with high dose (400 pg/ml) TNF-α for 24 hr. One set of TNF-α induced cells were used in a chase experiment in the absence of TNF-α for an additional 48 hr. The time points at which TNF-α is added or removed are shown by arrows on the top. C, Western blot studies measuring the expression of endogenous Nurr1, Nef, and β-tubulin in cells infected with either a non-targeting control shRNA or Nurr1-specific shRNA lentiviral vectors. The expression patterns from the TNF-α (400 pg/ml) stimulation and the chase step are shown. D, KD of endogenous Nurr1 strongly inhibits HIV silencing. The percentages of GFP + cells in the two cell lines, before treatment, at 24 hr post-TNF-α (400 pg/ml) stimulation, and at 72 hr after TNF-α withdrawal (chase) were analyzed by flow cytometry and calculated from three independent experiments. The difference in GFP expression between the two cell lines at 72 hr chase was statistically significant, with a p = 0.0078. E, Expression level of Nurr1 (red rectangles and lines) and the HIV provirus (black bar graph) in transcripts per million cellular transcripts are shown for each of the treatment steps in both non-targeting shRNA infected cells (on the left) and Nurr1-specific shRNA-infected cells (on the right half of the graph). The values shown reflect the average of three replicate RNA-Seq samples from two distinct shRNA constructs per control and Nurr1 knock down groups, with two standard deviations as error bars. The expression values for HIV and Nurr1 are shown on Y axes to the left and right, respectively.

Article Snippet: Two lentiviral constructs expressing human Nurr1-specific shRNA (5’GGTTCGCACAGACAGTTTAAA3’ and 5’ATACGTGTGTTTAGCAAATAA3’), one lentiviral construct expressing human CoREST-specific shRNA (5’CCCAATAATGGCCAGAATAAA3’), and two lentiviral constructs expressing control shRNAs (5’CCTAAGGTTAAGTCGCCCTCG3’ and 5’ CAACAAGATGAAGAGCACCA3’) were purchased from VectorBuilder.

Techniques: RNA Sequencing, shRNA, Infection, Construct, Knockdown, Western Blot, Expressing, Control, Flow Cytometry

Journal: bioRxiv

Article Title: The Nerve Growth Factor IB-like Receptor Nurr1 (NR4A2) Recruits CoREST Transcription Repressor Complexes to Silence HIV Following Proviral Reactivation in Microglial Cells

doi: 10.1101/2021.11.16.468784

Figure Lengend Snippet: A, Schematic illustration of Nurr1-mediated epigenetic silencing of active HIV in microglial cells by recruiting the CoREST/HDAC1/G9a/EZH2 repression complex to HIV promoter. B, ChIP-seq signals (numbers of sequence reads on Y axis) along the reporter HIV-1 pro-viral genome on the X axis, resulting from ChIP-seq analysis with antibodies to EZH2, G9a, HDAC1, CoREST, and control IgG, respectively, and sheared chromatins prepared from HC69 cells that were un-treated, induced with TNF-α (400 pg/ml) for 4 hr and 24 hr respectively, or used in a chase experiment by continuously culturing HC69 cells in the absence of TNF-α for 24 hr after stimulating the cells with TNF-α (400 pg/ml) for 24 hr and washing with PBS. Construction of ChIP-seq DNA libraries with the ChIP products, enrichment for HIV-1 specific sequences, and data analysis following Ion Torrent sequencing were described in Materials & Methods. Positions of ChIP sequence reads along the viral genome were marked. C & D , levels of CoREST (C) and G9a (D) in HIV 5’LTR (+30 to +134) in HC69-control shRNA (Control) and HC69-Nurr1 shRNA (Nurr1 KD) cell lines that were treated as described in B. The levels of CoREST and G9a in HIV 5’LTR were measured by qPCR and calculated as percentages of the amounts of ChIP products over input DNA from triplicate qPCR.

Article Snippet: Two lentiviral constructs expressing human Nurr1-specific shRNA (5’GGTTCGCACAGACAGTTTAAA3’ and 5’ATACGTGTGTTTAGCAAATAA3’), one lentiviral construct expressing human CoREST-specific shRNA (5’CCCAATAATGGCCAGAATAAA3’), and two lentiviral constructs expressing control shRNAs (5’CCTAAGGTTAAGTCGCCCTCG3’ and 5’ CAACAAGATGAAGAGCACCA3’) were purchased from VectorBuilder.

Techniques: ChIP-sequencing, Sequencing, Control, shRNA

Journal: bioRxiv

Article Title: The Nerve Growth Factor IB-like Receptor Nurr1 (NR4A2) Recruits CoREST Transcription Repressor Complexes to Silence HIV Following Proviral Reactivation in Microglial Cells

doi: 10.1101/2021.11.16.468784

Figure Lengend Snippet: A, Inhibition of HDAC1, G9a, and EZH2 blocked silencing of activated HIV in HC69 cells. HC69 cells were stimulated with high dose (400 pg/ml) TNF-α for 24 hr. After washing with PBS, the cells were cultured in the presence of DMSO (placebo, Control), HDAC inhibitor SAHA (2 μM), G9a inhibitor UNC0638 (2.5 μM), and EZH2 inhibitor GSK343 (2.5 μM), respectively, for 48 hr. The levels of GFP expression for each treatment were measured by flow cytometry and calculated from three independent experiments, with p values between the control and treatment with each inhibitor indicated. B, Verification of CoREST KD by Western blot detection of CoREST protein expression in HC69 cell lines stably expressing control shRNA or CoREST-specific shRNA. C, Verification of EZH2 and G9a KO by Western blot detection of G9a and EZH2 protein expression in HC69 cells stably expressing CRISPR/Cas9 and G9a or EZH2 specific gRNA, which were compared to the control HC69 cells stably expressing CRISPR/Cas9 without gRNA. β-tubulin was used as a loading control for all Western blot analysis. D, CoREST KD prevents HIV silencing. The HC69-control shRNA and HC69-CoREST-shRNA cells were untreated, induced with high dose (400 pg/ml) TNF-α for 24 hr, or used in a chase experiment by continuous culturing the cells for 48 hr after TNF-α stimulation for 24 hr and washes with PBS. GFP expression levels of all cells were measured by flow cytometry and the mean values were calculated from three independent experiments. Significant differences were observed between the HC69-control shRNA and HC69-CoREST shRNA cell lines. E, G9a and EZH2 KO prevents HIV silencing. Evaluation of the HC69 cell lines expressing G9a or EZH2 specific gRNA or empty vector by flow cytometry following the same protocol as in panel D. There was a significant difference between HC69-vector and HC69 EZH2 or G9a KO cell lines at 48 hr after TNF-α withdrawal, with p < 0.01.

Article Snippet: Two lentiviral constructs expressing human Nurr1-specific shRNA (5’GGTTCGCACAGACAGTTTAAA3’ and 5’ATACGTGTGTTTAGCAAATAA3’), one lentiviral construct expressing human CoREST-specific shRNA (5’CCCAATAATGGCCAGAATAAA3’), and two lentiviral constructs expressing control shRNAs (5’CCTAAGGTTAAGTCGCCCTCG3’ and 5’ CAACAAGATGAAGAGCACCA3’) were purchased from VectorBuilder.

Techniques: Inhibition, Cell Culture, Control, Expressing, Flow Cytometry, Western Blot, Stable Transfection, shRNA, CRISPR, Plasmid Preparation

Journal: Journal of Cancer

Article Title: CLEC4M is associated with poor prognosis and promotes cisplatin resistance in NSCLC patients

doi: 10.7150/jca.30139

Figure Lengend Snippet: Establishment of A549 and H1299 cell lines with stable knockdown or overexpression of CLEC4M. (A-D) CLEC4M expression was measured after lentiviruses containing shCLEC4M and CLEC4M were transfected into the cells (n=3). (E and H) CLEC4M mRNA levels were measured after transfection (n=3). Data are presented as the mean ± SD, ** p < 0.01, *** p < 0.001 vs. shCon or Vector.

Article Snippet: In this study, lentiviruses containing small hairpin RNA (shRNA) specifically targeting human CLEC4M and non-specific shRNA (shControl group), and lentiviruses containing CLEC4M and vector control (vector group) were purchased from Genechem (Shanghai, China).

Techniques: Knockdown, Over Expression, Expressing, Transfection, Plasmid Preparation

Journal: Journal of Cancer

Article Title: CLEC4M is associated with poor prognosis and promotes cisplatin resistance in NSCLC patients

doi: 10.7150/jca.30139

Figure Lengend Snippet: CLEC4M enhances cisplatin resistance in lung cancer cells.(A) The relationship between CLEC4M expression and the IC 50 value for cisplatin was analysed by linear regression after screening of CLEC4M expression data in 107 lung cell lines obtained from the GDSC database. (B-E) Cell viability was determined by CCK-8 (n=4). Cells transfected with lentiviruses containing shCLEC4M (B and C) or containing CLEC4M (D and E) were reseeded in 96-well plates and treated with increasing concentrations (0, 6.25, 12.5, 25, 50 and 100 μM) of cisplatin for 24 h before measurement. Data are presented as the mean ± SD.

Article Snippet: In this study, lentiviruses containing small hairpin RNA (shRNA) specifically targeting human CLEC4M and non-specific shRNA (shControl group), and lentiviruses containing CLEC4M and vector control (vector group) were purchased from Genechem (Shanghai, China).

Techniques: Expressing, CCK-8 Assay, Transfection

Journal: Scientific Reports

Article Title: Upregulation of CYP2S1 by oxaliplatin is associated with p53 status in colorectal cancer cell lines

doi: 10.1038/srep33078

Figure Lengend Snippet: (A) p53+/+HCT116 cells, SW480 cells, HT29 cells and p53−/− HCT116 cells were treated with oxaliplatin (20 μM) for 24 h; total protein was extracted, and the protein levels of total p53 and CYP2S1 were analyzed by western blotting. The results shown are representative of three experiments. (B ) Ectopic expression of p53 markedly increased SW480 cells’ CYP2S1 transcriptional activity after Oxaliplatin treatment for 24 h. Data are represented as mean ± s.d., **p < 0.01. (C, D) Effect of oxaliplatin treated on CYP2S1 mRNA expression. Isogenic p53+/+ HCT116 and p53−/− HCT116 cells were treated with oxaliplatin for 24 h; total RNA was extracted, and CYP2S1 mRNA expression was analyzed by Taqman-based real-time RT-PCR analysis. GAPDH was used as an endogenous control. (E ) Cells were treated as described in panels C and D. CYP2S1 protein expression was analyzed by western blotting. GAPDH was used as an endogenous control. Representative results from three experiments are shown.

Article Snippet: Cells were grown on a 6-well plate (1 × 10 5 cells per well) for 24 h and transfected with human-specific CYP2S1 short hairpin RNA (shRNA) plasmids (Genechem shRNA, NM_030622) using Lipofectamine 2000 (Gibco 11668-027) following the manufacturer’s instructions.

Techniques: Western Blot, Expressing, Activity Assay, Quantitative RT-PCR, Control

Journal: Scientific Reports

Article Title: Upregulation of CYP2S1 by oxaliplatin is associated with p53 status in colorectal cancer cell lines

doi: 10.1038/srep33078

Figure Lengend Snippet: CYP2S1 knockdown conferred cell survival advantage after oxaliplatin treatment to cells harboring wild-type p53 but not to isogenic cells lacking p53. Cells were treated with the shNT (denotes non-targeting control shRNA) or CYP2S1 shRNA, respectively. Cell viability after Oxaliplatin (20 μM) treatment was determined by the CCK8 assay. (A,B ) p53+/+ HCT116 CYP2S1 knockdown cells are highly resistant to oxaliplatin treatment. Reduced CYP2S1 protein expression in cells was confirmed by Western blot, one of three representative experiments is shown. (C,D ) Total RNA was extracted and the mRNA levels of the CYP2S1 gene were analyzed in qRT–PCR analysis. Results are of the average from three experiments. Data are represented as mean ± s.d., *p < 0.05, **p < 0.01.

Article Snippet: Cells were grown on a 6-well plate (1 × 10 5 cells per well) for 24 h and transfected with human-specific CYP2S1 short hairpin RNA (shRNA) plasmids (Genechem shRNA, NM_030622) using Lipofectamine 2000 (Gibco 11668-027) following the manufacturer’s instructions.

Techniques: Knockdown, Control, shRNA, CCK-8 Assay, Expressing, Western Blot, Quantitative RT-PCR

Journal: Scientific Reports

Article Title: Upregulation of CYP2S1 by oxaliplatin is associated with p53 status in colorectal cancer cell lines

doi: 10.1038/srep33078

Figure Lengend Snippet: Identical (2 × 10 6 ) amounts of each cells were injected subcutaneously into the flanks of nude mice. When tumors reached approximately 100 mm 3 , the mice received either PBS or oxaliplatin (10 mg/kg) intraperitoneally (day 0). A second dose of either PBS or oxaliplatin was administered three days later. Tumor growth was analyzed by caliper measurements every 2 days. (A,B) Comparison of tumor volume between each group (means ± SD, n = 5). Oxaliplatin treatment markedly reduced tumor volume in p53+/+HCT116 tumor xenografts. *p < 0.05, **p < 0.01. (C) Tumors were harvested on day 12. Tumors from each group were analyzed for the presence of CYP2S1 and p53 by western blotting. GAPDH was used as an internal control. (D ) Total proteins were extracted and the protein levels of the CYP2S1 were analyzed in Western blot analysis. Results are of the average from three experiments. Data are represented as mean ± s.d., ** p < 0.01. (E,F ) Weights of xenograft tumours derived from p53+/+ or p53−/−HCT116 cells expressing CYP2S1 knockdown or control (shRNA or shNT, respectively) after oxaliplatin treatment. n = 5 mice per group.

Article Snippet: Cells were grown on a 6-well plate (1 × 10 5 cells per well) for 24 h and transfected with human-specific CYP2S1 short hairpin RNA (shRNA) plasmids (Genechem shRNA, NM_030622) using Lipofectamine 2000 (Gibco 11668-027) following the manufacturer’s instructions.

Techniques: Injection, Comparison, Western Blot, Control, Derivative Assay, Expressing, Knockdown, shRNA

Journal: Scientific Reports

Article Title: Upregulation of CYP2S1 by oxaliplatin is associated with p53 status in colorectal cancer cell lines

doi: 10.1038/srep33078

Figure Lengend Snippet: When CRC cells are exposed to oxaliplatin, activation of p53 leads to upregulation of CYP2S1 transcription and translation and a decrease in endogenous PGE2 biosynthesis and β-catenin expression, which ultimately decreases colorectal cell survival and proliferation.

Article Snippet: Cells were grown on a 6-well plate (1 × 10 5 cells per well) for 24 h and transfected with human-specific CYP2S1 short hairpin RNA (shRNA) plasmids (Genechem shRNA, NM_030622) using Lipofectamine 2000 (Gibco 11668-027) following the manufacturer’s instructions.

Techniques: Activation Assay, Expressing